Skip to content

Prime edit mode fails with wrong strand #599

@slogemann1

Description

@slogemann1

Hello,
first of all, thank you very much for your work on CRISPResso. Recently I used CRISPResso (v2.3.3) to evaluate prime editing data from paired-end reads from 156bp MiSeq sequencing data. I used prime editing mode and provided all parameters for the pegRNA including spacer sequence, scaffold, and extension. Based on my primers for creating the library the sequenced amplicon after merging is the reverse compliment of the expected input. CRISPResso failed even when providing the option --prime_editing_override_sequence_checks

Expected behavior
I would expect either a more informative error message or information in the documentation since I only discovered that there is no attempt to check against the reverse compliment of the amplicon by looking through the source code.

To reproduce
Take prime editor amplicon sequencing data with paired-end reads that has the reverse compliment of the expected sequence. You should be able to generate such a dataset by running seqtk seq -r on both files of correct orientation data, since that was ultimately my solution to fix this error.
Run CRISPResso as follows (example amplicon left for clarity):

CRISPResso -r1 r1.fq.gz -r2 r2.fq.gz --amplicon_seq "GGCTTGGTGGAAGGAGGGCTGGGCTGCTGGCCGGGTAACGTTCTGCTCGTGTATCACCGGAATGGAGATGTACCCCCGCGGGAGCTGGTGACTGCCCAGGCTGCTCCTGCCGGAGGAAGGCAGGCTGGCCGAGGAGGATGAG" -p 10 --prime_editing_pegRNA_spacer_seq "GCGGGGGTACATCTCCATTC" --prime_editing_pegRNA_extension_seq "TCGTGTATCACAGGAATGGAGATGTA" --prime_editing_pegRNA_scaffold_seq "GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC" --prime_editing_override_prime_edited_ref_seq "GGCTTGGTGGAAGGAGGGCTGGGCTGCTGGCCGGGTAACGTTCTGCTCGTGTATCACAGGAATGGAGATGTACCCCCGCGGGAGCTGGTGACTGCCCAGGCTGCTCCTGCCGGAGGAAGGCAGGCTGGCCGAGGAGGATGAG"

Debug output

INFO  @ Thu, 08 Jan 2026 16:20:37 (0.0% done):

                                                   ~~~CRISPResso 2~~~
                            -Analysis of genome editing outcomes from deep sequencing data-

                                                            _
                                                           '  )
                                                           .-'
                                                          (____
                                                       C)|     \
                                                         \     /
                                                          \___/

                                               [CRISPResso version 2.3.3]
[Note that as of version 2.3.0 FLASh and Trimmomatic have been replaced by fastp for read merging and trimming. Accordingly, the --flash_command and --trimmomatic_command parameters have been replaced with --fastp_command. Also, --trimmomatic_options_string has been replaced with --fastp_options_string.

Also in version 2.3.2, when running CRISPRessoPooled in mixed-mode (amplicon file and genome are provided) the default behavior will be as if the --demultiplex_only_at_amplicons parameter is provided. This change means that reads and amplicons do not need to align to the exact locations.]
                           [For support contact [email protected] or [email protected]]


WARNING @ Thu, 08 Jan 2026 16:20:37 (0.0% done):
         Folder CRISPResso_on_r1_r2 already exists.

DEBUG @ Thu, 08 Jan 2026 16:20:37 (0.5% done):
         CRISPRessoPro not installed


INFO  @ Thu, 08 Jan 2026 16:20:37 (0.5% done):
         pegRNA spacer alignment:
Forward (correct orientation):
-----------------------------------------------------------------------------GCGGG----GGTACATCTCCATTC-----------------------------------------
GGCTTGGTGGAAGGAGGGCTGGGCTGCTGGCCGGGTAACGTTCTGCTCGTGTATCACCGGAATGGAGATGTACCCCCGCGGGAGCTGGTGACTGCCCAGGCTGCTCCTGCCGGAGGAAGGCAGGCTGGCCGAGGAGGATGAG
Score: 9.155
Reverse (incorrect orientation):
---------------------------------------------------------------GCGGGGGTACATCTCCATTC-----------------------------------------------------------
CTCATCCTCCTCGGCCAGCCTGCCTTCCTCCGGCAGGAGCAGCCTGGGCAGTCACCAGCTCCCGCGGGGGTACATCTCCATTCCGGTGATACACGAGCAGAACGTTACCCGGCCAGCAGCCCAGCCCTCCTTCCACCAAGCC
Score: 14.085

Traceback (most recent call last):
  File "/mnt/c/Users/user/Desktop/wsl/Crispresso2/python-venv/lib/python3.12/site-packages/CRISPResso2/CRISPRessoCORE.py", line 2855, in main
    raise CRISPRessoShared.BadParameterException(error_msg)
CRISPResso2.CRISPRessoShared.BadParameterException: The prime editing pegRNA spacer sequence appears to be given in the 3'->5' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5'->3' order.
CRITICAL @ Thu, 08 Jan 2026 16:20:37 (0.5% done):
         Traceback (most recent call last):
  File "/mnt/c/Users/user/Desktop/wsl/Crispresso2/python-venv/lib/python3.12/site-packages/CRISPResso2/CRISPRessoCORE.py", line 2855, in main
    raise CRISPRessoShared.BadParameterException(error_msg)
CRISPResso2.CRISPRessoShared.BadParameterException: The prime editing pegRNA spacer sequence appears to be given in the 3'->5' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5'->3' order.


CRITICAL @ Thu, 08 Jan 2026 16:20:37 (0.5% done):
         Parameter error, please check your input.

ERROR: The prime editing pegRNA spacer sequence appears to be given in the 3'->5' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5'->3' order.

I was unable to find any option in the CRISPRESSO documentation that would let me get around this error, since the --prime_editing_override_sequence_checks option also fails when looking at the extension. I would suggest as a simplest solution to clarify what exactly the prime editor mode does in the documentation and that it expects a certain orientation and perhaps link to a solution with seqtk processing. Alternatively I would suggest an additional flag to take the reverse compliment of the merged sequences before processing or automatically checking and accounting for this without additional user input but writing it to the console as a warning. In case I have time I could try working on it myself if you see any of these as viable options.

Hopefully I did not oversee any solutions or make any other mistakes, otherwise please let me know. Thank you very much for your work!

Metadata

Metadata

Assignees

No one assigned

    Labels

    No labels
    No labels

    Type

    No type

    Projects

    No projects

    Milestone

    No milestone

    Relationships

    None yet

    Development

    No branches or pull requests

    Issue actions